Stem-loop sequence sof-MIR408c

AccessionMI0001767 (change log)
DescriptionSaccharum officinarum miR408c stem-loop
Gene family MIPF0000102; MIR408
Literature search

9 open access papers mention sof-MIR408c
(90 sentences)

Stem-loop
   agaagau     -    -u    a      u       a   u    u     cau    aaaauuuccaauuucuguccuccgcuaggccgcuacugcauuucuguuugcuugcucacaaaacggagggauuugugagaguuau 
5'        gggua uggu  ggag caggga gaggcag gca ggga ggggc   caac                                                                                     c
          ||||| ||||  |||| |||||| ||||||| ||| |||| |||||   ||||                                                                                      
3'        cccgu gcca  ccuc gucccu cuccguc cgu cccu cuucg   guug                                                                                     a
   ---cguu     u    cc    g      u       a   c    c     -uu    ugguccuguggucgacucgagagucgggagaguccaguccgguaguggugaaguggucccuccguggaagaaacaagaaagacgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR408c

Accession MIMAT0001669
Sequence

247 - 

cugcacugccucuucccuggc

 - 267

Get sequence
Evidence by similarity; MI0001149

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).