Stem-loop sequence sof-MIR408b

AccessionMI0001766 (change log)
DescriptionSaccharum officinarum miR408b stem-loop
Gene family MIPF0000102; MIR408
Literature search

9 open access papers mention sof-MIR408b
(90 sentences)

Stem-loop
   agaagau     -    -u    a      u       a   u    u     cau    aaaauuuccaauuucuguccuccgcuaggccgcuacugcauuuauguuugcuugcucacaaaacggagggauuugugagaguuau 
5'        gggua uggu  ggag caggga gaggcag gca ggga ggggc   caac                                                                                     c
          ||||| ||||  |||| |||||| ||||||| ||| |||| |||||   ||||                                                                                      
3'        cccgu gcca  ccuc gucccu cuccguc cgu cccu cuucg   guug                                                                                     a
   ---cguu     u    cc    g      u       a   c    c     -uu    ugguccuguggucgacucgagagucgggagaguccaguccgguaguggugaaguggucccuccguggaagaaacaagaaagacgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR408b

Accession MIMAT0001668
Sequence

247 - 

cugcacugccucuucccuggc

 - 267

Get sequence
Evidence by similarity; MI0001149

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).