Stem-loop sequence sof-MIR156

AccessionMI0001754 (change log)
DescriptionSaccharum officinarum miR156 stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sof-MIR156
(73 sentences)

Stem-loop
   ggu     a   --gugga          -     -        a      gccu   uu      ugaacg   g 
5'    ggaga gag       ggcugacaga agaga gugagcac cauggu    uuc  gcauga      auc a
      ||||| |||       |||||||||| ||||| |||||||| ||||||    |||  ||||||      |||  
3'    ucucu cuc       ccgacugucu ucucu cacucgug guaucg    aag  cguacu      ugg g
   --c     -   aagauug          c     u        c      ----   cu      ------   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sof-miR156

Accession MIMAT0001656
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Evidence by similarity; MI0000654

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).