miRBase entry: mmu-mir-451a

Stem-loop mmu-mir-451a


Accession
MI0001730
Symbol
MGI: Mir451a
Description
Mus musculus mmu-mir-451a precursor miRNA
Gene family
MIPF0000148; mir-451

Literature search
132 open access papers mention mmu-mir-451a
(708 sentences)

Sequence

3358336 reads, 9802 reads per million, 99 experiments
cuugggaauggcgaggAAACCGUUACCAUUACUGAGUUuaguaaugguaacgguucucuugcugcucccaca
..(((((.((((((((.(((((((((((((((((....))))))))))))))))).)))))))).)))))..

Structure
cu     a        A                 A 
  uggga uggcgagg AACCGUUACCAUUACUG G
  ||||| |||||||| |||||||||||||||||  
  acccu gucguucu uuggcaaugguaaugau U
ac     c        c                 U 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 78073170-78073241 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-451a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-451a

Accession MIMAT0001632
Description Mus musculus mmu-miR-451a mature miRNA
Sequence 17 - AAACCGUUACCAUUACUGAGUU - 38
Evidence experimental
cloned [1-3], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267