![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mghv-mir-M1-9 |
||||||||||||||||||||||||||||||||
Accession | MI0001677 (change log) | |||||||||||||||||||||||||||||||
Previous IDs | mhv-miR-M1-9 | |||||||||||||||||||||||||||||||
Description | Mouse gammaherpesvirus 68 miR-M1-9 stem-loop | |||||||||||||||||||||||||||||||
Stem-loop |
--u u c u u aua 5' gaggu cc ggcaaaugu gga ag g ||||| || ||||||||| ||| || 3' uucca gg ccguuuaca ucu uc g uuu - u c - aau |
|||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mghv-miR-M1-9 |
|
Accession | MIMAT0001573 |
Previous IDs | mhv-miR-M1-9 |
Sequence |
39 - ucacauuugccuggaccuuuuu - 60 |
Evidence | experimental; cloned [1-3], 454 [4], Illumina [5] |
References |
|
1 |
PMID:15782219
"Identification of microRNAs of the herpesvirus family"
Nat Methods. 2:269-276(2005).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:19948768
"Mature and functional viral miRNAs transcribed from novel RNA polymerase III promoters"
RNA. 16:170-185(2010).
|
4 |
PMID:20668074
"Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68"
J Virol. 84:10266-10275(2010).
|
5 |
PMID:20660200
"Identification of novel microRNA-like molecules generated from herpesvirus and host tRNA transcripts"
J Virol. 84:10344-10353(2010).
|