Stem-loop sequence rno-mir-429

Accession

MI0001643 (change log)

Description

Rattus norvegicus miR-429 stem-loop

Gene family

MIPF0000019; mir-8

Literature search

18 open access papers mention rno-mir-429
(43 sentences)

Stem-loop

   u   ugcu        u -          ug       cu   u 
5'  gcc    gauggaug c uuaccagaca  guuagau  gga g
    |||    |||||||| | ||||||||||  |||||||  |||  
3'  cgg    cuaccugc g aauggucugu  uaaucug  ucu u
   -   -uac        c u          ca       --   a 

Deep sequencing

653057 reads, 578 reads per million, 461 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244).

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr5: 173488331-173488415 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-429

• rno-mir-200b: chr5: 173490144-173490238 [-]
• rno-mir-200a: chr5: 173489366-173489454 [-]
• rno-mir-3548: chr5: 173489353-173489472 [+]
• rno-mir-429: chr5: 173488331-173488415 [-]

Database links

• EntrezGene:Mir429
• miRBase Tracker:MI0001643

Mature sequence rno-miR-429

• Accession: MIMAT0001538
• Sequence: 53 - uaauacugucugguaaugccgu - 74
• Deep sequencing: 652485 reads, 460 experiments
• Evidence: experimental; cloned [2], Northern [2]
• Predicted targets:
  • TargetScanVert:rno-miR-429
  • miRDB:rno-miR-429
  • microrna.org:rno-miR-429

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).