Stem-loop sequence mmu-mir-429

Accession

MI0001642 (change log)

Symbol

MGI:Mir429

Description

Mus musculus miR-429 stem-loop

Gene family

MIPF0000019; mir-8

Literature search

80 open access papers mention mmu-mir-429
(228 sentences)

Stem-loop

   c   cu        u -          ug       cu   u 
5'  cug  gauggaug c uuaccagaca  guuagau  gga g
    |||  |||||||| | ||||||||||  |||||||  |||  
3'  ggc  cuaccugc g aauggucugu  uaaucug  ucu c
   c   ac        c u          ca       --   a 

Deep sequencing

111903 reads, 383 reads per million, 99 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MI0000244).

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr4: 156053905-156053987 [-]
• Overlapping transcripts:

  sense

  OTTMUST00000117417 ; Ttll10-005; intron 1

  OTTMUST00000025771 ; Ttll10-001; intron 1

  OTTMUST00000031955 ; RP23-118E21.8-001; exon 2

  ENSMUST00000184348 ; Ttll10-005; intron 1

  ENSMUST00000097731 ; Ttll10-001; intron 1

  ENSMUST00000138361 ; Gm13648-001; exon 2

Clustered miRNAs

< 10kb from mmu-mir-429

• mmu-mir-200b: chr4: 156055681-156055750 [-]
• mmu-mir-200a: chr4: 156054896-156054985 [-]
• mmu-mir-429: chr4: 156053905-156053987 [-]

Database links

• EntrezGene:Mir429
• MGI:Mir429
• RNAcentral:URS000075AE5E_10090
• miRBase Tracker:MI0001642

Mature sequence mmu-miR-429-5p

• Accession: MIMAT0017178
• Previous IDs: mmu-miR-429*
• Sequence: 14 - gucuuaccagacaugguuaga - 34
• Deep sequencing: 42 reads, 12 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS00001BB658_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-429-5p
  • miRDB:mmu-miR-429-5p

Mature sequence mmu-miR-429-3p

• Accession: MIMAT0001537
• Previous IDs: mmu-miR-429
• Sequence: 51 - uaauacugucugguaaugccgu - 72
• Deep sequencing: 111788 reads, 99 experiments
• Evidence: experimental; cloned [2], Illumina [3-4]
• Database links:
  • RNAcentral:URS00002D8367_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-429-3p
  • miRDB:mmu-miR-429-3p
  • microrna.org:mmu-miR-429-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).