miRBase entry: hsa-mir-429

Stem-loop hsa-mir-429


Accession
MI0001641
Symbol
HGNC: MIR429
Description
Homo sapiens hsa-mir-429 precursor miRNA
Gene family
MIPF0000019; mir-8

Literature search
194 open access papers mention hsa-mir-429
(660 sentences)

Sequence

33901 reads, 318 reads per million, 96 experiments
cgccggccgaugggcgucuuaccagacaugguuagaccuggcccucugucUAAUACUGUCUGGUAAAACCGUccauccgcugc
...((((.((((((((..((((((((((..(((((((..........)))))))..))))))))))...)))))))).)))).

Structure
cgc    c        -uc          ug       cugg 
   cggc gaugggcg   uuaccagaca  guuagac    c
   |||| ||||||||   ||||||||||  |||||||     
   gucg cuaccUGC   AAUGGUCUGU  UAAUcug    c
--c    c        CAA          CA       ucuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
Xie et al. [1] refer to this sequence by the internal identifier MIR201. The sequence is unrelated to mouse mir-201 (MIR:MI0000244).

Genome context
chr1: 1169005-1169087 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-429
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-429 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-429

Accession MIMAT0001536
Description Homo sapiens hsa-miR-429 mature miRNA
Sequence 51 - UAAUACUGUCUGGUAAAACCGU - 72
Evidence experimental
cloned [1-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15891114
    Clustering and conservation patterns of human microRNAs
    "Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H"
    "Nucleic Acids Res (2005) 33:2697-2706

  4. PubMed ID: 15735639
    Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals
    "Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M"
    "Nature (2005) 434:338-345