Stem-loop sequence aga-mir-282

AccessionMI0001619 (change log)
DescriptionAnopheles gambiae miR-282 stem-loop
Gene family MIPF0000150; mir-282
Literature search

1 open access papers mention aga-mir-282
(2 sentences)

Stem-loop
   -guaa    gcua           uc      u      uaca  u 
5'      caga    aucuagccucu  uaggcu ugucug    gu u
        ||||    |||||||||||  |||||| ||||||    ||  
3'      gucu    uggauuggaga  guccga acagac    cg c
   cgauc    aaag           cu      u      caaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 17496155-17496247 [-]
intergenic
Database links

Mature sequence aga-miR-282

Accession MIMAT0001514
Sequence

12 - 

aaucuagccucuucuaggcuuugucugu

 - 39

Get sequence
Evidence by similarity; MI0000367