![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aga-mir-276 |
|||||
Accession | MI0001614 (change log) | ||||
Description | Anopheles gambiae miR-276 stem-loop | ||||
Gene family | MIPF0000124; mir-276 | ||||
Literature search |
2 open access papers mention aga-mir-276 | ||||
Stem-loop |
------- gacug uc a ag -uaa g 5' ggu cca agcg gguau aguuccuacgg uc a ||| ||| |||| ||||| ||||||||||| || 3' ccg ggu ucgu ccaua ucaaggauguu ag u ccauuug --aua uc g cu ucaa u |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
miR-276-5p and miR-276-3p were cloned in Anopheles stephensi and mappedt to the A. gambiae genome [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aga-miR-276-5p |
|
Accession | MIMAT0001509 |
Previous IDs | aga-miR-276 |
Sequence |
14 - agcgagguauagaguuccua - 33 |
Evidence | by similarity; MI0000359 |
Mature sequence aga-miR-276-3p |
|
Accession | MIMAT0006782 |
Sequence |
55 - uaggaacuucauaccgugcucu - 76 |
Evidence | by similarity; MI0000359 |
References |
|
1 |
PMID:18500992
"Cloning, characterization, and expression of microRNAs from the Asian malaria mosquito, Anopheles stephensi"
BMC Genomics. 9:244(2008).
|