Stem-loop sequence aga-mir-124

AccessionMI0001604 (change log)
DescriptionAnopheles gambiae miR-124 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
        uu   c             ag    g    --u   a 
5' cguuu  cuc ugguguucacugu  gccu uaug   ucu u
   |||||  ||| |||||||||||||  |||| ||||   ||| u
3' gcaag  gag accguaaguggcg  cgga auac   agg g
        -c   a             ca    -    uuu   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 29001980-29002062 [+]
intergenic
Database links

Mature sequence aga-miR-124

Accession MIMAT0001499
Sequence

53 - 

uaaggcacgcggugaaugccaag

 - 75

Get sequence
Evidence by similarity; MI0000373