![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ame-mir-2-1 |
||||||||||||||||
Accession | MI0001589 (change log) | |||||||||||||||
Description | Apis mellifera miR-2-1 stem-loop | |||||||||||||||
Gene family | MIPF0000049; mir-2 | |||||||||||||||
Literature search |
3 open access papers mention ame-mir-2-1 | |||||||||||||||
Stem-loop |
ugu ac - - cugau g 5' ggcgcg gc cgcuca caaag ugguugugauaug ac a |||||| || |||||| ||||| ||||||||||||| || 3' cugcgc cg gcgagu guuuc accgacacuauac ug g -ug gu a g ----u c |
|||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
Mature sequence ame-miR-2-3p |
|
Accession | MIMAT0001485 |
Sequence |
54 - uaucacagccagcuuugaugagc - 76 |
Evidence | experimental; RTPCR [1], Illumina [2] |
References |
|
1 |
PMID:17543122
"Computational and transcriptional evidence for microRNAs in the honey bee genome"
Genome Biol. 8:R97(2007).
|
2 |
PMID:20491979
"Correlated expression patterns of microRNA genes with age-dependent behavioural changes in honeybee"
Insect Mol Biol. 19:431-439(2010).
|
3 |
PMID:22409512
"Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome"
Genes Brain Behav. 11:660-670(2012).
|