Stem-loop sequence ame-mir-219

AccessionMI0001582 (change log)
DescriptionApis mellifera miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

1 open access papers mention ame-mir-219
(1 sentences)

Stem-loop
   aa      -  --   ag  aa    u    aa            ucuaaac 
5'   uugaau gu  cuc  gc  ugau gucc  acgcaauucuug       g
     |||||| ||  |||  ||  |||| ||||  ||||||||||||       g
3'   aacuua cg  gag  cg  acua cagg  uguguuaagaac       u
   -c      g  ug   cu  cg    -    gg            uaaagca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000057.5: 42977-43078 [-]
intergenic
Database links

Mature sequence ame-miR-219-5p

Accession MIMAT0001478
Sequence

20 - 

ugauuguccaaacgcaauucuug

 - 42

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).