Stem-loop sequence ame-mir-133

AccessionMI0001579 (change log)
DescriptionApis mellifera miR-133 stem-loop
Gene family MIPF0000029; mir-133
Literature search

4 open access papers mention ame-mir-133
(10 sentences)

Stem-loop 
            g  -            cac  gu     a a   ca 
5' uaauguuaa cu uagcugguugaa   gg  caaau u ucg  c
   ||||||||| || ||||||||||||   ||  ||||| | |||   
3' auuacaguu ga gucgaccaacuu   cc  guuua g agu  g
            -  u            -cc  ug     c c   ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000069.5: 5323138-5323226 [+]
intergenic
Database links

Mature sequence ame-miR-133-3p

Accession MIMAT0001475
Sequence

57 -  

uugguccccuucaaccagcugu

 - 78

Get sequence
Evidence experimental; RTPCR [1], Illumina [2-3]

References

1
PMID:20491979 "Correlated expression patterns of microRNA genes with age-dependent behavioural changes in honeybee" Behura SK, Whitfield CW Insect Mol Biol. 19:431-439(2010).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).