Stem-loop sequence ame-bantam

AccessionMI0001574 (change log)
DescriptionApis mellifera bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

4 open access papers mention ame-bantam
(8 sentences)

Stem-loop
       -----a       cu                 ga    uaga 
5' ucga      aacgaaa  gguuuucacaaugauuu  caga    u
   ||||      |||||||  |||||||||||||||||  ||||     
3' agcu      uuguuuu  ucgaaaguguuacuaga  gucu    u
       gaaaag       ag                 --    uagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000065.5: 8950590-8950676 [-]
intergenic
Database links

Mature sequence ame-bantam-3p

Accession MIMAT0001470
Sequence

50 - 

ugagaucauugugaaagcugauu

 - 72

Get sequence
Evidence experimental; RTPCR [1], Illumina [2]

References

1
PMID:17543122 "Computational and transcriptional evidence for microRNAs in the honey bee genome" Weaver DB, Anzola JM, Evans JD, Reid JG, Reese JT, Childs KL, Zdobnov EM, Samanta MP, Miller J, Elsik CG Genome Biol. 8:R97(2007).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).