Stem-loop sequence sbi-MIR159a

AccessionMI0001572 (change log)
Previous IDssbi-MIR159
DescriptionSorghum bicolor miR159 stem-loop
Gene family MIPF0000010; MIR159
Literature search

3 open access papers mention sbi-MIR159a
(3 sentences)

Stem-loop
   a   a       a   u     u  ag    cuuuu  -u   -    u c   g    u     guuc    uau         ucauguauguguguauguacucuagaggg 
5'  gcg agcuccu uca uccaa ga  ggcc     ca  ggg uggu c gcu cucg ucaug    ccac   ccuaucuca                             c
    ||| ||||||| ||| ||||| ||  ||||     ||  ||| |||| | ||| |||| |||||    ||||   |||||||||                             c
3'  cgu ucgaggg agu agguu cu  ccgg     gu  ccc gcca g cga gagc aguac    ggug   ggauagagu                             c
   a   c       a   u     u  cg    ---uc  uc   u    c u   g    c     guuu    uuc         uucugacugcugguguacuuagagaagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sbi-miR159a

Accession MIMAT0001468
Previous IDssbi-MIR159;sbi-miR159
Sequence

204 - 

uuuggauugaagggagcucug

 - 224

Get sequence
Evidence by similarity; MI0001092

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).