Stem-loop sequence sbi-MIR171e

AccessionMI0001570 (change log)
DescriptionSorghum bicolor miR171e stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

2 open access papers mention sbi-MIR171e
(2 sentences)

Stem-loop
   --    g      gacg      c         u             - u   ugcuuc       u 
5'   agga gaagaa    acaugg gugguauug uucggcucauguc c ucu      gagucug c
     |||| ||||||    |||||| ||||||||| ||||||||||||| | |||      |||||||  
3'   ucuu cuucuu    uguacu cacuauaac aagccgaguguag g agg      uuuaggc g
   ag    a      ---a      -         c             u u   -----u       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 53651339-53651462 [+]
intergenic
Database links

Mature sequence sbi-miR171e

Accession MIMAT0001466
Previous IDssbi-MIR171e
Sequence

85 - 

gugagccgaaccaauaucacu

 - 105

Get sequence
Evidence by similarity; MI0001147

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).