Stem-loop sequence sbi-MIR171c

AccessionMI0001567 (change log)
DescriptionSorghum bicolor miR171c stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

2 open access papers mention sbi-MIR171c
(2 sentences)

Stem-loop
   aga   --   c       ca        a             ucauc   agcaaa 
5'    acg  aga gacaugg  ugguauug cuuggcucaucuc     cac      c
      |||  ||| |||||||  |||||||| |||||||||||||     |||       
3'    ugc  ucu cuguacu  acuauaac gagccgaguggag     gug      u
   ---   ga   a       uc        c             --ucc   aacacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 17069962-17070070 [-]
intergenic
Database links

Mature sequence sbi-miR171c

Accession MIMAT0001463
Previous IDssbi-MIR171c
Sequence

70 - 

gaggugagccgagccaauauc

 - 90

Get sequence
Evidence by similarity; MI0001138

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).