Stem-loop sequence sbi-MIR171a

AccessionMI0001566 (change log)
DescriptionSorghum bicolor miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171a
(6 sentences)

Stem-loop
   uugguu    -     -ag  c                        caucgcccggcaaggugacuuaaauuuugcgcuuuc 
5'       ggcu gagag   ug gauguuggcaugguucaaucaaau                                    g
         |||| |||||   || ||||||||||||||||||||||||                                     
3'       ccga cucuu   ac cuauaaccgugccgaguuaguuug                                    a
   ---uau    u     cca  a                        ugccacggaccuuuguggagggacguggagcuagcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 7802995-7803155 [-]
intergenic
Database links

Mature sequence sbi-miR171a

Accession MIMAT0001462
Previous IDssbi-MIR171a
Sequence

122 - 

ugauugagccgugccaauauc

 - 142

Get sequence
Evidence by similarity; MI0001137

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).