Stem-loop sequence sbi-MIR171d

AccessionMI0001565 (change log)
DescriptionSorghum bicolor miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171d
(2 sentences)

Stem-loop
   -aua      u    g  au         u       c     --    cucuccgauccucagcucguguccauug 
5'     auggaa agua cu  gauguuggc cggcuca ucaga  ccac                            c
       |||||| |||| ||  ||||||||| ||||||| |||||  ||||                            g
3'     uaccuu ucau ga  cuauaaccg gccgagu agucu  ggug                            a
   uaua      c    -  cu         u       u     uu    cuggucgcuguauauauguacuagcuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 78121346-78121498 [-]
intergenic
Database links

Mature sequence sbi-miR171d

Accession MIMAT0001461
Previous IDssbi-MIR171d
Sequence

114 - 

ugauugagccgugccaauauc

 - 134

Get sequence
Evidence by similarity; MI0001135

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).