Stem-loop sequence sbi-MIR171b

AccessionMI0001564 (change log)
DescriptionSorghum bicolor miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

2 open access papers mention sbi-MIR171b
(5 sentences)

Stem-loop
   au     -c  c   c    g                    c      uc       aga  aga g 
5'   ggccg  cg gcg gacg gguauuggcgcgguucaauu gagagc  gagcccu   cu   c c
     |||||  || ||| |||| |||||||||||||||||||| ||||||  |||||||   ||   | c
3'   ucggu  gu cgc cugc cuauaaccgugccgaguuag cucucg  cucgggg   ga   g a
   --     aa  u   c    a                    u      -u       -ga  gag g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr7: 7691161-7691292 [+]
intergenic
Database links

Mature sequence sbi-miR171b

Accession MIMAT0001460
Previous IDssbi-MIR171b
Sequence

93 - 

ugauugagccgugccaauauc

 - 113

Get sequence
Evidence by similarity; MI0001133

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).