Stem-loop sequence sbi-MIR167c

AccessionMI0001555 (change log)
DescriptionSorghum bicolor miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention sbi-MIR167c
(6 sentences)

Stem-loop
   cu   c    -       gu         c                -  --g    -   -    -  c 
5'   uug uggu gugagag  ugaagcugc agcaugaucugguggc cg   ccgg ccg gcgu cu u
     ||| |||| |||||||  ||||||||| |||||||||||||||| ||   |||| ||| |||| ||  
3'   aac acca cgcucuc  acuucgacg uuguacuagaccgcug gc   ggcu ggc cgcg ga c
   -a   c    a       uc         -                c  aga    a   u    u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 56429519-56429649 [+]
intergenic
Database links

Mature sequence sbi-miR167c

Accession MIMAT0001451
Previous IDssbi-MIR167c
Sequence

20 - 

ugaagcugccagcaugaucug

 - 40

Get sequence
Evidence by similarity; MI0001114

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).