Stem-loop sequence sbi-MIR167e

AccessionMI0001554 (change log)
DescriptionSorghum bicolor miR167e stem-loop
Gene family MIPF0000125; MIR167_2
Literature search

3 open access papers mention sbi-MIR167e
(6 sentences)

Stem-loop
   agug    -a    a   u           c              u   uauauau    a  a     -ga     -    gac    a     cg 
5'     gugc  ccac agu ggugaagcugc agcaugaucugaug cuu       auua uu ccucu   uuucu cccu   uguu uggau  a
       ||||  |||| ||| ||||||||||| |||||||||||||| |||       |||| || |||||   ||||| ||||   |||| |||||   
3'     cacg  ggug ucg cuacuuugaug ucguacuggacuac gag       uaau aa ggaga   aagga gggg   auag acuua  u
   --ua    ag    g   c           -              -   -------    -  -     aag     a    agu    -     ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr8: 59225502-59225680 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR167e
sbi-MIR167ichr8: 59223214-59223345 [+]
sbi-MIR167echr8: 59225502-59225680 [+]
Database links

Mature sequence sbi-miR167e

Accession MIMAT0001450
Previous IDssbi-MIR167e
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Evidence by similarity; MI0001111

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).