Stem-loop sequence sbi-MIR167f

AccessionMI0001552 (change log)
DescriptionSorghum bicolor miR167f stem-loop
Gene family MIPF0000125; MIR167_2
Literature search

3 open access papers mention sbi-MIR167f
(8 sentences)

Stem-loop
   uccg    -a   g   u               c         gaaacuag        ccuuuuacugauuuccaucuagccugcaucuaua 
5'     gugc  cua agg ggaugaagcugccag augaucuga        ugcuugau                                  u
       ||||  ||| ||| ||||||||||||||| |||||||||        ||||||||                                   
3'     cacg  ggu uuc ucuacuuugacgguc ugcuagacu        gcgaauug                                  a
   --aa    ac   a   u               -         -----aga        auaguagucugguacuaaguacguaguuccauau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 26092744-26092922 [+]
intergenic
Database links

Mature sequence sbi-miR167f

Accession MIMAT0001448
Previous IDssbi-MIR167f
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Evidence by similarity; MI0001109

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).