Stem-loop sequence sbi-MIR167d

AccessionMI0001551 (change log)
DescriptionSorghum bicolor miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention sbi-MIR167d
(8 sentences)

Stem-loop
   gug        u u     c         -             ----   --g  ga    uauu    a      c 
5'    gugcaucc c aguag ugaagcugc cagcaugaucuga    uga   gu  gguu    ugcu guuggu a
      |||||||| | ||||| ||||||||| |||||||||||||    |||   ||  ||||    |||| |||||| c
3'    cacguagg g ucguc acuuugacg gucguacuagacu    acu   ca  ccgg    acga caaucg a
   -ua        u c     u         u             agca   aaa  ac    uagu    -      g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 4980559-4980706 [-]
intergenic
Database links

Mature sequence sbi-miR167d

Accession MIMAT0001447
Previous IDssbi-MIR167d
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Evidence by similarity; MI0001109

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).