Stem-loop sequence sbi-MIR156d

AccessionMI0001548 (change log)
DescriptionSorghum bicolor miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

8 open access papers mention sbi-MIR156d
(23 sentences)

Stem-loop
   -   -acc    gag  a          -a    -          --a   -a   cc       a 
5'  ugg    ucug   ug gugaugacag  agag agagagcaca   ccc  gca  agcgagg g
    |||    ||||   || ||||||||||  |||| ||||||||||   |||  |||  ||||||| a
3'  acc    ggac   gc cgcuacuguc  ucuc ucucucgugu   ggg  cgu  ucgcucc a
   a   cacc    --a  -          ac    g          gcc   ag   cu       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 62805800-62805924 [-]
intergenic
Database links

Mature sequence sbi-miR156d

Accession MIMAT0001444
Previous IDssbi-MIR156d
Sequence

21 - 

ugacagaagagagagagcaca

 - 41

Get sequence
Evidence by similarity; MI0001090

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).