Stem-loop sequence sbi-MIR399b

AccessionMI0001546 (change log)
DescriptionSorghum bicolor miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399b
(6 sentences)

Stem-loop
   uagcu      --ga    ca   u           c     --u       g      u au 
5'      cagggu    gaau  cag gcagcucuccu uggca   gaaggcu agagag c  g
        ||||||    ||||  ||| ||||||||||| |||||   ||||||| |||||| |  a
3'      gucccg    cuua  guc cgucgagagga accgu   uuuccgg ucuuuu g  g
   --aac      auua    cc   c           a     ccc       -      - ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 9764453-9764573 [-]
intergenic
Database links

Mature sequence sbi-miR399b

Accession MIMAT0001442
Previous IDssbi-MIR399b
Sequence

82 - 

ugccaaaggagagcugcccug

 - 102

Get sequence
Evidence by similarity; MI0001061

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).