Stem-loop sequence sbi-MIR399f

AccessionMI0001545 (change log)
DescriptionSorghum bicolor miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399f
(5 sentences)

Stem-loop
   caua       c a     a c    c uu       g          uugaauuuuacuuu    g 
5'     ugcgagu g ggauu c gggc a  ucuccuu ggcagaguaa              gcug a
       ||||||| | ||||| | |||| |  ||||||| ||||||||||              ||||  
3'     auguuua c ccuaa g cccg u  agaggaa ccgucucguu              uggc u
   uaua       - a     c a    - uu       a          --------------    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 48187250-48187369 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR399f
sbi-MIR399hchr10: 48189611-48189742 [+]
sbi-MIR399fchr10: 48187250-48187369 [-]
Database links

Mature sequence sbi-miR399f

Accession MIMAT0001441
Previous IDssbi-MIR399f
Sequence

81 - 

ugccaaaggagauuugcccag

 - 101

Get sequence
Evidence by similarity; MI0001057

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).