Stem-loop sequence sbi-MIR399e

AccessionMI0001544 (change log)
DescriptionSorghum bicolor miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399e
(5 sentences)

Stem-loop
   acaugc     -  ----      a c   ug        c       aacuuggcuggucgccugg 
5'       ggggc ca    ugcauu c ggg  ggucuccu uggcagu                   u
         ||||| ||    |||||| | |||  |||||||| |||||||                   c
3'       cccug gu    acguaa g ccc  uuagagga accguca                   c
   ------     a  uuug      c a   gu        a       cagacgugcguccauagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr9: 55507371-55507496 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR399e
sbi-MIR399cchr9: 55505804-55505933 [-]
sbi-MIR399echr9: 55507371-55507496 [+]
sbi-MIR399gchr9: 55511807-55511931 [+]
Database links

Mature sequence sbi-miR399e

Accession MIMAT0001440
Previous IDssbi-MIR399e
Sequence

87 - 

ugccaaaggagauuugcccag

 - 107

Get sequence
Evidence by similarity; MI0001057

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).