Stem-loop sequence sbi-MIR399d

AccessionMI0001543 (change log)
DescriptionSorghum bicolor miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

3 open access papers mention sbi-MIR399d
(5 sentences)

Stem-loop
   gu c      a             -          c       -   u aucgucgucgucaucgacggcugguucuguguucauccggauccaucgugcagc 
5'   g aggcug agacaguuguagg cagcucuccu uggcagg cgg c                                                      c
     | |||||| ||||||||||||| |||||||||| ||||||| ||| |                                                      g
3'   c uucgac ucugucagcgucc guugagagga accgucc gcu g                                                      u
   -u c      c             c          a       u   - cugcaugcacgcacguauuacguacguacauuggcuuauaaugacguacguacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr10: 1578286-1578490 [+]
intergenic
Database links

Mature sequence sbi-miR399d

Accession MIMAT0001439
Previous IDssbi-MIR399d
Sequence

166 - 

ugccaaaggagaguugcccug

 - 186

Get sequence
Evidence by similarity; MI0001056

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).