Stem-loop sequence sbi-MIR396c

AccessionMI0001540 (change log)
DescriptionSorghum bicolor miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention sbi-MIR396c
(9 sentences)

Stem-loop
   uucaa  cc   c   gc                   a     ccuccuccuccucucucuuagaaggguagcuuugaac 
5'      gu  aug cau  cuuuccacagcuuucuuga cuucu                                     a
        ||  ||| |||  ||||||||||||||||||| |||||                                     u
3'      ca  uac gua  gaagggugucgaaagaacu gaaga                                     c
   aggaa  -a   a   aa                   g     aaccucucucucucucucucucucucucucucucucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 66726748-66726909 [+]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR396c
sbi-MIR396cchr4: 66726748-66726909 [+]
sbi-MIR396achr4: 66733975-66734099 [-]
Database links

Mature sequence sbi-miR396c

Accession MIMAT0001436
Previous IDssbi-MIR396c
Sequence

21 - 

uuccacagcuuucuugaacuu

 - 41

Get sequence
Evidence by similarity; MI0001048

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).