Stem-loop sequence sbi-MIR396a

AccessionMI0001539 (change log)
DescriptionSorghum bicolor miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

3 open access papers mention sbi-MIR396a
(14 sentences)

Stem-loop
   aca   - c   c    c  c            c         aug  -  u    c  u u  a 
5'    ugg c cuc uugc gu uuccacagcuuu uugaacugc   cu gg agug ug g gc u
      ||| | ||| |||| || |||||||||||| |||||||||   || || |||| || | ||  
3'    acc g gag gacg ua agggugucgaaa aacuugacg   ga cc uuau ac c ug c
   --g   a a   a    u  a            u         -ga  a  -    a  - u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 66733975-66734099 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR396a
sbi-MIR396achr4: 66733975-66734099 [-]
sbi-MIR396cchr4: 66726748-66726909 [+]
Database links

Mature sequence sbi-miR396a

Accession MIMAT0001435
Previous IDssbi-MIR396a
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Evidence by similarity; MI0001013

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).