Dead miRNA entry

miRNA accession:
MI0001535
miRNA ID:
sbi-MIR395c
Forward to:
MI0001536
Comment:
MIR395c overlaps MIR395d and MIR395e, so is removed.

Previous miRNA entry

Stem-loop sequence sbi-MIR395c

AccessionMI0001535 (change log)
DescriptionSorghum bicolor miR395c stem-loop
Stem-loop
   -  a   uuuu   a     u            -            au c      cc     c  -ga    gg       ugugcuacaugagccaagugugugc 
5'  gc cua    gag gcuuu gugaaguguuug ggggaacucuug  g cacuaa  auuug ua   gguu  ccaagug                         u
    || |||    ||| ||||| |||||||||||| ||||||||||||  | ||||||  ||||| ||   ||||  |||||||                          
3'  cg gau    uuc cgaaa cacuucacaaac ucucuugaggac  c gugguu  ugaac au   uuaa  gguuuac                         a
   u  a   -uuu   a     -            g            cc u      --     u  aua    -a       acuaaacagaaguuuaguaaaguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 57228201-57228273 [-]
intergenic
Clustered miRNAs
< 10kb from sbi-MIR395c
sbi-MIR395echr6: 57228710-57228814 [-]
sbi-MIR395dchr6: 57228519-57228621 [-]
sbi-MIR395cchr6: 57228201-57228273 [-]
sbi-MIR395fchr6: 57228009-57228130 [-]
Database links