Stem-loop sequence sbi-MIR394a

AccessionMI0001531 (change log)
DescriptionSorghum bicolor miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

1 open access papers mention sbi-MIR394a
(2 sentences)

Stem-loop
   cuuuacaua   - g      -      u c           --uu  ccau  u  ga 
5'          cug a aguucc uuggca u uguccaccucc    gc    cg ca  u
            ||| | |||||| |||||| | |||||||||||    ||    || ||   
3'          gau u ucgagg aaccgu a acagguggagg    cg    gu gu  a
   ---ucuccg   g g      u      c u           uuuu  --uu  -  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr2: 66830969-66831078 [+]
intergenic
Database links

Mature sequence sbi-miR394a

Accession MIMAT0001427
Previous IDssbi-MIR394a
Sequence

21 - 

uuggcauucuguccaccucc

 - 40

Get sequence
Evidence by similarity; MI0001027

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).