![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-434 |
||||||||||||||||||||||||||||
Accession | MI0001526 (change log) | |||||||||||||||||||||||||||
Symbol | MGI:Mir434 | |||||||||||||||||||||||||||
Description | Mus musculus miR-434 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000439; mir-434 | |||||||||||||||||||||||||||
Literature search |
![]()
19 open access papers mention mmu-mir-434 | |||||||||||||||||||||||||||
Stem-loop |
ucgacucug -a c c c ug uacu 5' gguuugaacca ag ucga u augguu aaccau u ||||||||||| || |||| | |||||| |||||| 3' ccaagcuuggu uc agcu a uaccaa uuggug a ------cua cc - c c gu cuua |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||
Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-434-5p |
|
Accession | MIMAT0001421 |
Sequence |
23 - gcucgacucaugguuugaacca - 44 |
Deep sequencing | 218782 reads, 78 experiments |
Evidence | experimental; PCR [1], cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-434-3p |
|
Accession | MIMAT0001422 |
Sequence |
60 - uuugaaccaucacucgacuccu - 81 |
Deep sequencing | 695491 reads, 92 experiments |
Evidence | experimental; PCR [1], cloned [2-3], Illumina [4-5] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15854907
"RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus"
Curr Biol. 15:743-749(2005).
|
2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|