Stem-loop sequence sbi-MIR167b

AccessionMI0001514 (change log)
DescriptionSorghum bicolor miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

3 open access papers mention sbi-MIR167b
(6 sentences)

Stem-loop
   u       - -              aacg  a    -uc  c         c     -   u   uu   uugucuccauggagaagacagcggcaaagc 
5'  gaagcug c cagcaugaucuaac    gc uugc   cu cguguagcg ccugu gcu gcu  ugc                              u
    ||||||| | ||||||||||||||    || ||||   || ||||||||| ||||| ||| |||  |||                              u
3'  cuuugac g gucguacuagauug    ug aacg   ga gugcgucgu gggcg cgg cgg  aug                              a
   a       a u              guag  -    uuc  a         u     g   u   gu   cuuuucggucguucgauucgcuucguuucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr1: 7229987-7230184 [+]
intergenic
Database links

Mature sequence sbi-miR167b

Accession MIMAT0001408
Sequence

1 - 

ugaagcugccagcaugaucua

 - 21

Get sequence
Evidence by similarity; MI0000208

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).