Stem-loop sequence sbi-MIR156a

AccessionMI0001504 (change log)
DescriptionSorghum bicolor miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

9 open access papers mention sbi-MIR156a
(28 sentences)

Stem-loop
   u       -    -        a     -c     acg      
5'  gacagaa gaga gugagcac cggcg  gacga   gcaua 
    ||||||| |||| |||||||| |||||  |||||   |||| a
3'  cugucuu cucu cacucgug gccgc  cugcu   uguau 
   a       u    u        c     uc     gua      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr4: 5326257-5326340 [-]
intergenic
Database links

Mature sequence sbi-miR156a

Accession MIMAT0001398
Sequence

1 - 

ugacagaagagagugagcac

 - 20

Get sequence
Evidence by similarity; MI0000178

References

1
"Identifying microRNAs in plant genomes" Maher C, Timmermans M, Stein L, Ware D Proc IEEE CSB :718-723(2004).
2
PMID:15660154 "Sorghum genome sequencing by methylation filtration" Bedell JA, Budiman MA, Nunberg A, Citek RW, Robbins D, Jones J, Flick E, Rholfing T, Fries J, Bradford K, McMenamy J, Smith M, Holeman H, Roe BA, Wiley G, Korf IF, Rabinowicz PD, Lakey N, McCombie WR, Jeddeloh JA, Martienssen RA PLoS Biol. 3:e13(2005).
3
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).