Stem-loop sequence dps-mir-317

AccessionMI0001358 (change log)
DescriptionDrosophila pseudoobscura miR-317 stem-loop
Gene family MIPF0000144; mir-317
Stem-loop
   u   --  u         aua    --     c      ugaauau 
5'  gca  ac gccguuggg   cacc  cugug ucgcuu       g
    |||  || |||||||||   ||||  ||||| ||||||        
3'  cgu  ug cgguaaccu   gugg  gacac agugaa       g
   a   cu  c         aug    uc     a      cgaacgu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 5030001-5030090 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-317
dps-mir-3172: 5030001-5030090 [-]
dps-mir-2772: 5020595-5020694 [-]
Database links

Mature sequence dps-miR-317

Accession MIMAT0001263
Sequence

55 - 

ugaacacagcuggugguauccaau

 - 78

Get sequence
Evidence by similarity; MI0000429, MI0000429