Stem-loop sequence dps-mir-309

AccessionMI0001354 (change log)
DescriptionDrosophila pseudoobscura miR-309 stem-loop
Gene family MIPF0000140; mir-3
Stem-loop
         c         ug      u    caac 
5' auuaua gauaaacuu  uucagu uugc    u
   |||||| |||||||||  |||||| ||||     
3' uaauau cuguuugaa  ggguca gacg    u
         u         gu      c    uucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 12677889-12677956 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-309
dps-mir-3093: 12677889-12677956 [-]
dps-mir-33: 12677755-12677827 [-]
dps-mir-2863: 12677589-12677685 [-]
dps-mir-43: 12677418-12677498 [-]
dps-mir-53: 12677240-12677311 [-]
dps-mir-6-13: 12677098-12677177 [-]
dps-mir-6-23: 12676947-12677029 [-]
dps-mir-6-33: 12676804-12676883 [-]
Database links

Mature sequence dps-miR-309

Accession MIMAT0001259
Sequence

43 - 

gcacugggugaaguuugucuua

 - 64

Get sequence
Evidence by similarity; MI0000421, MI0000421