Stem-loop sequence dps-mir-286

AccessionMI0001345 (change log)
DescriptionDrosophila pseudoobscura miR-286 stem-loop
Gene family MIPF0000225; mir-286
Stem-loop
   ---         aaug    u   -               --uuacca    
5'    uuaaaauua    gcga ugu cgguuuggucgcuuu        ggg 
      |||||||||    |||| ||| |||||||||||||||        || u
3'    gauuuuaau    ugcu aca gccagaucagugaag        ccu 
   uaa         aucg    c   a               cgaacuag    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 12677589-12677685 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-286
dps-mir-3093: 12677889-12677956 [-]
dps-mir-33: 12677755-12677827 [-]
dps-mir-2863: 12677589-12677685 [-]
dps-mir-43: 12677418-12677498 [-]
dps-mir-53: 12677240-12677311 [-]
dps-mir-6-13: 12677098-12677177 [-]
dps-mir-6-23: 12676947-12677029 [-]
dps-mir-6-33: 12676804-12676883 [-]
Database links

Mature sequence dps-miR-286

Accession MIMAT0001250
Sequence

62 - 

ugacuagaccgaacacucgugcu

 - 84

Get sequence
Evidence by similarity; MI0000380, MI0000380