Stem-loop sequence dps-mir-34

AccessionMI0001317 (change log)
DescriptionDrosophila pseudoobscura miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   aauug   a  -   uu        u  u   c        --ua c    aua 
5'      gcu ug cgc  uggcagug gg uag ugguugug    g caaa   u
        ||| || |||  |||||||| || ||| ||||||||    | ||||    
3'      cga ac gcg  gccgucac uc auc accgacac    c guuu   u
   -----   -  a   cc        u  u   -        uuac a    ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 5019569-5019668 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-34
dps-mir-2772: 5020595-5020694 [-]
dps-mir-342: 5019569-5019668 [-]
Database links

Mature sequence dps-miR-34

Accession MIMAT0001223
Sequence

17 - 

uggcagugugguuagcugguug

 - 38

Get sequence
Evidence by similarity; MI0000371, MI0000371