Stem-loop sequence dps-mir-13b-1

AccessionMI0001311 (change log)
DescriptionDrosophila pseudoobscura miR-13b-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
      -ug           u      ccu    uacu 
5' cca   ucguuaaaaug uuguga   uaug    c
   |||   ||||||||||| ||||||   ||||    u
3' ggu   agcaguuuuac gacacu   auac    u
      uug           c      ---    uaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 9825091-9825159 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-13b-1
dps-mir-2c2: 9824690-9824792 [+]
dps-mir-13a2: 9824939-9825012 [+]
dps-mir-13b-12: 9825091-9825159 [+]
Database links

Mature sequence dps-miR-13b

Accession MIMAT0001218
Sequence

44 - 

uaucacagccauuuugacgagu

 - 65

Get sequence
Evidence by similarity; MI0000135, MI0000135