Stem-loop sequence dps-mir-13a

AccessionMI0001310 (change log)
DescriptionDrosophila pseudoobscura miR-13a stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
       u   c       -c        a   uugcau 
5' uacg aac caucaaa  gguuguga aug      u
   |||| ||| |||||||  |||||||| |||      u
3' gugc uug guaguuu  ccgacacu uac      a
       u   a       ua        a   uaaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
2: 9824939-9825012 [+]
intergenic
Clustered miRNAs
< 10kb from dps-mir-13a
dps-mir-2c2: 9824690-9824792 [+]
dps-mir-13a2: 9824939-9825012 [+]
dps-mir-13b-12: 9825091-9825159 [+]
Database links

Mature sequence dps-miR-13a

Accession MIMAT0001217
Sequence

47 - 

uaucacagccauuuugaugagu

 - 68

Get sequence
Evidence by similarity; MI0000133, MI0000133