Stem-loop sequence dps-mir-6-2

AccessionMI0001301 (change log)
DescriptionDrosophila pseudoobscura miR-6-2 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
   cc     c       c  ug   c       uuauccacc  u 
5'   aaccg agggaac gc  cug ugauaua         ca c
     ||||| ||||||| ||  ||| |||||||         ||  
3'   uuggu uuucuug cg  gac acuauau         gu u
   --     u       u  gu   -       --cuuuaca  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 12676947-12677029 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-6-2
dps-mir-3093: 12677889-12677956 [-]
dps-mir-33: 12677755-12677827 [-]
dps-mir-2863: 12677589-12677685 [-]
dps-mir-43: 12677418-12677498 [-]
dps-mir-53: 12677240-12677311 [-]
dps-mir-6-13: 12677098-12677177 [-]
dps-mir-6-23: 12676947-12677029 [-]
dps-mir-6-33: 12676804-12676883 [-]
Database links

Mature sequence dps-miR-6

Accession MIMAT0001208
Sequence

58 - 

uaucacaguggcuguucuuuuu

 - 79

Get sequence
Evidence by similarity; MI0000126, MI0000126