Stem-loop sequence dps-mir-6-1

AccessionMI0001299 (change log)
DescriptionDrosophila pseudoobscura miR-6-1 stem-loop
Gene family MIPF0000119; mir-6
Stem-loop
   -uuugaag             ug     c     ---   c 
5'         uagagagaauagu  cugug uauau   guc u
           |||||||||||||  ||||| |||||   |||  
3'         guuuuucuugucg  gacac auaua   cag u
   aaauccau             gu     u     ucu   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 12677098-12677177 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-6-1
dps-mir-3093: 12677889-12677956 [-]
dps-mir-33: 12677755-12677827 [-]
dps-mir-2863: 12677589-12677685 [-]
dps-mir-43: 12677418-12677498 [-]
dps-mir-53: 12677240-12677311 [-]
dps-mir-6-13: 12677098-12677177 [-]
dps-mir-6-23: 12676947-12677029 [-]
dps-mir-6-33: 12676804-12676883 [-]
Database links

Mature sequence dps-miR-6

Accession MIMAT0001208
Sequence

50 - 

uaucacaguggcuguucuuuuu

 - 71

Get sequence
Evidence by similarity; MI0000126, MI0000126