Stem-loop sequence dps-mir-5

AccessionMI0001298 (change log)
DescriptionDrosophila pseudoobscura miR-5 stem-loop
Gene family MIPF0000309; mir-5
Stem-loop
   --    -       c               cgu    u 
5'   gcua aaaggaa gaucguugugauaug   uaau c
     |||| ||||||| |||||||||||||||   |||| a
3'   cgau uuuccuu uuagugacacuauac   auug c
   cg    a       -               ---    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
3: 12677240-12677311 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-5
dps-mir-3093: 12677889-12677956 [-]
dps-mir-33: 12677755-12677827 [-]
dps-mir-2863: 12677589-12677685 [-]
dps-mir-43: 12677418-12677498 [-]
dps-mir-53: 12677240-12677311 [-]
dps-mir-6-13: 12677098-12677177 [-]
dps-mir-6-23: 12676947-12677029 [-]
dps-mir-6-33: 12676804-12676883 [-]
Database links

Mature sequence dps-miR-5

Accession MIMAT0001207
Sequence

5 - 

aaaggaacgaucguugugauaug

 - 27

Get sequence
Evidence by similarity; MI0000123, MI0000123