Stem-loop sequence gga-mir-204-1

Accession

MI0001271 (change log)

Description

Gallus gallus miR-204-1 stem-loop

Gene family

MIPF0000042; mir-204

Literature search

11 open access papers mention gga-mir-204-1
(22 sentences)

Stem-loop

   gucaacagugucuguucau     ccg     u          a     u    gagaau 
5'                    gugac   uggac ucccuuuguc uccua gccu      a
                      |||||   ||||| |||||||||| ||||| ||||      u
3'                    uacug   acuug agggaaacgg agggu cggg      a
   ------------------c     uca     c          a     -    ggaagu 

Deep sequencing

848 reads, 0 reads per million, 5 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chrZ: 35181161-35181264 [-]
• Overlapping transcripts:

  sense

  ENSGALT00000024411 ; TRPM3-201; intron 6

Database links

• EntrezGene:
• RNAcentral:URS000075AD4A_9031
• miRBase Tracker:MI0001271

Mature sequence gga-miR-204

• Accession: MIMAT0001156
• Sequence: 33 - uucccuuugucauccuaugccu - 54
• Deep sequencing: 1561 reads, 5 experiments
• Evidence: by similarity; MI0000284
• Database links:
  • RNAcentral:URS000029D9F1_9031
• Predicted targets:
  • TargetScanVert:gga-miR-204
  • miRDB:gga-miR-204

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).