![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-7-3 |
|||||
Accession | MI0001269 (change log) | ||||
Description | Gallus gallus miR-7-3 stem-loop | ||||
Gene family | MIPF0000022; mir-7 | ||||
Literature search |
![]()
10 open access papers mention gga-mir-7-3 | ||||
Stem-loop |
cugu gcu a a g u gauu 5' ggucug cugugugg ag cua ugauuu guuguuau u |||||| |||||||| || ||| |||||| |||||||| a 3' cuagac gacauacc uc gau acuaaa caacagug u -cuu -ac g c - - gaaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gga-miR-7 |
|
Accession | MIMAT0001157 |
Sequence |
19 - uggaagacuagugauuuuguug - 40 |
Deep sequencing | 132586 reads, 5 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
References |
|
1 |
"
Unpublished.
|
2 |
PMID:18463306
"Conservation of small RNA pathways in platypus"
Genome Res. 18:995-1004(2008).
|
3 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|
4 |
PMID:18463306
"Conservation of small RNA pathways in platypus"
Genome Res. 18:995-1004(2008).
|
5 |
PMID:18256158
"MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs"
J Virol. 82:4007-4015(2008).
|