Stem-loop sequence gga-mir-199-1

Accession

MI0001245 (change log)

Previous IDs

gga-mir-199a-2;gga-mir-199a-1

Description

Gallus gallus miR-199-1 stem-loop

Gene family

MIPF0000040; mir-199

Literature search

7 open access papers mention gga-mir-199-1
(20 sentences)

Stem-loop

   ------c    - u c     c       u        c   u   gacu 
5'        ucca c c gucug ccagugu cagacuac ugu cag    a
          |||| | | ||||| ||||||| |||||||| ||| |||     
3'        gggu g g cggau gguuaca gucugaug aca guu    c
   ccacaua    c u u     u       c        -   u   agag 

Deep sequencing

99351 reads, 1.36e+03 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Chicken has two loci predicted to express miR-199. mir-199-2 (MI0001220) is homologous to mir-199a-2 in human (MI0000281) and mouse (MI0000713). mir-199-1 (MI0001245) is homologous to mir-199b in human (MI0000282) and mouse (MI0000714). The expression of chicken miR-199 has been verified experimentally [2].

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr17: 5571579-5571672 [+]
• Overlapping transcripts:

  antisense

  ENSGALT00000007750 ; intron 15

Database links

• EntrezGene:
• RNAcentral:URS000075BBF1_9031
• miRBase Tracker:MI0001245

Mature sequence gga-miR-199-5p

• Accession: MIMAT0001152
• Previous IDs: gga-miR-199a;gga-miR-199
• Sequence: 15 - cccaguguucagacuaccuguuc - 37
• Deep sequencing: 22116 reads, 5 experiments
• Evidence: experimental; cloned [2], Northern [2]
• Database links:
  • RNAcentral:URS0000554A4F_9031
• Predicted targets:
  • TargetScanVert:gga-miR-199-5p
  • miRDB:gga-miR-199-5p

Mature sequence gga-miR-199-3p

• Accession: MIMAT0003721
• Previous IDs: gga-miR-199*
• Sequence: 53 - uacaguagucugcacauugg - 72
• Deep sequencing: 176606 reads, 5 experiments
• Evidence: experimental; cloned [2], Northern [2]
• Database links:
  • RNAcentral:URS000075AFAC_9031
• Predicted targets:
  • TargetScanVert:gga-miR-199-3p
  • miRDB:gga-miR-199-3p

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.