Stem-loop sequence gga-mir-205b

AccessionMI0001238 (change log)
DescriptionGallus gallus miR-205b stem-loop
Gene family MIPF0000058; mir-205
Literature search

4 open access papers mention gga-mir-205b
(4 sentences)

Stem-loop 
   auacacuacuagg    uc      cc       c   c        uca  gc 
5'              gccu  cugaug  cuucauu cac ggaaucug   gu  a
                ||||  ||||||  ||||||| ||| ||||||||   ||   
3'              cgga  gacuac  gaaguaa gug cuuuagac   ca  g
   ---------ucga    ga      cc       a   a        ---  aa
Get sequence
Deep sequencing
116 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 1273692-1273789 [-]
sense
Database links

Mature sequence gga-miR-205b

Accession MIMAT0001164
Sequence

26 -  

cccuucauuccaccggaaucug

 - 47

Get sequence
Deep sequencing114 reads, 5 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
" McBride D, Carre W, Law A, Clinton M Unpublished.